Authors: Zhuo-Xing Shi, SKLO, Sun Yat-Sen University; Ying-Dong He, BGI-Shenzhen
(If you are looking for a single cell matrix interactive transformation tool you can visit this link directly: https://github.com/shizhuoxing/scISA-Tools/wiki/scMatrixInteraction)
You can be found in the following web page and download CellRanger 3.1.0: https://www.10xgenomics.com/support/software/cell-ranger/downloads/previous-versions
Single-cell RNA sequencing is a powerful technique that advances gene expression regulation research to a higher resolution level for single cells. Recent advancements in scRNA-Seq methods (e.g., Droplet-based) allow thousands of cells to be captured and sequenced in a relatively short time frame at a fraction of the cost. They rely on capture of polyadenylated mRNA transcripts, followed by cDNA synthesis, pooling, amplification, library construction, and cDNA sequencing.
A major challenge for scRNA research is that the most widely used single cell RNA sequencing only generates short reads from one end of a cDNA template, thus limiting the reconstruction of highly diverse isoform such as alternative splicing and structural variation. Recent advances in long-read sequencing technologies present a potential solution to the shortcomings of short-read sequencing, as full-length cDNA reads can now encompass the entire sequence of transcripts. However, these long-read technologies typically suffer from higher error rates (Oxford Nanopore) and/or lower sequencing depth (PacBio) than short-read instruments.
Based on our previous development works, and by combining 10x genomics platform and HIT-scISOseq library construction technology, we have significantly improved the throughput of single-cell RNA sequencing using PacBio Sequel II platform. This has made it possible for us to obtain sufficient high-accuracy reads, and subsequently parse cell barcode, UMI and full-length transcript information in one dataset for thousands of single cells. It's really amazing!
In this repo, I will provide the tool set for analyzing HIT-scISOseq data starting from raw data. This is a comprehensive tool including basic data processing, cellBC extraction, expression matrix generation, and so on. It has been highly modularized so that you can combine various modules to address your need.
For citation and more detailed information, please see our preprint paper: High-throughput and high-accuracy single-cell RNA isoform analysis using PacBio circular consensus sequencing
- SMRTlink 8.0 or later, you can install it in light way:
smrtlink_*.run --rootdir smrtlink --smrttools-only - ncbi-blast-2.10.0+ or later
- R-3.4.1 or later with
ggplot2 | gridExtra | grid | Seurat | DropletUtils - CellRanger 3.1.0
- cDNA_Cupcake
Export smrtlink blast R to your path first.
export PATH=$PATH:/smrtlink/smrtcmds/bin
export PATH=$PATH:/ncbi-blast-2.10.0+/bin
export PATH=$PATH:/R-3.4.1/bin
ccs *.subreads.bam ccs.bam --min-passes 0 --min-length 50 --max-length 21000 --min-rq 0.75 -j 20
Start from SMRTlink8.0, CCS4.0 significantly speeds up the analysis and can be easily parallelized by using --chunk.
Note: the example_data folder in this repo have an example.ccs.bam for test use, which contain 5000 CCS reads produced from BGI patented HIT-scISOseq library construction protocol.
samtools view ccs.bam | awk '{print ">"$1"\n"$10}' > ccs.fa
samtools view ccs.bam | awk '{print "@"$1"\n"$10"\n+\n"$11}' > ccs.fq
makeblastdb -in primer.fa -dbtype nucl
blastn -query ccs.fa -db primer.fa -outfmt 7 -word_size 5 > mapped.m7
The following primer sequence is commonly used for PacBio original scIsoSeq library construction protocol with 10x genomics and BGI patented HIT-scISOseq library construction protocol with 10x genomics.
$ cat primer.fa
>primer_F
AAGCAGTGGTATCAACGCAGAGTACATGGG
>primer_S
CTACACGACGCTCTTCCGATCT
Have to note that, here primer_F means 5’ primer, primer_S means 3’ primer, you must set the name in this format for classify_by_primer utility.
Here is an example for classifying CCS generate from PacBio original scIsoSeq library construction protocol with 10x genomics and BGI patented HIT-scISOseq library construction protocol with 10x genomics.
perl classify_by_primer.pl -blastm7 mapped.m7 -ccsfq ccs.fq -min_primerlen 16 -min_isolen 50 -outdir ./
classify_by_primer wraps a tool to detect full-length transcript from CCS base on PacBio original scIsoSeq library construction protocol with 10x genomics and BGI patented HIT-scISOseq library construction protocol with 10x genomics.
$ perl classify_by_primer.pl -h
Usage: perl classify_by_primer.pl -blastm7 mapped.m7 -ccsfq ccs.fq -min_primerlen 16 -min_isolen 50 -outdir ./
Options:
-blastm7*: result of primer blast to ccs.fa in blast -outfmt 7 format
-ccsfq*: the ccs.fq you want to classify to get full-length transcript
-min_primerlen*: the minimum primer alignment length in ccs.fa
-min_isolen*: the minimum output's transcript length whithout polyA tail
-outdir*: output directory
-help: print this help
After running finished, will find three file in your specified output path: isoseq_flnc.BarcodeUMI.fastq, isoseq_flnc.Transcript.fastq, isoseq.PrimerStat.csv
After FLNC detection and primer, cellBC, UMI and polyA tail trimming, the remaining fraction of each isoforms FLNC reads were aligned to the reference genome with minimap2.
minimap2 -ax splice -t 6 -uf --secondary=no -C5 -t 5 ref.genome.fa isoseq_flnc.Transcript.fastq > isoseq_flnc.Transcript.sam
After FLNC mapping to reference genome, using gffcompare(https://ccb.jhu.edu/software/stringtie/gffcompare.shtml) to mapping FLNC to reference annotation.
perl sam2gff.pl isoseq_flnc.Transcript.sam > isoseq_flnc.Transcript.gff
The script sam2gff.pl were original from: https://github.com/gpertea/gscripts/blob/master/sam2gff.pl
gffcompare -r ref.genes.gtf isoseq_flnc.Transcript.gff -o flnc
perl filter.tmap.pl flnc.isoseq_flnc.Transcript.gff.tmap > flnc.filtered.tmap
We adopted a similar strategy of 10x Genomics CellRanger for cellBC and UMI correction, we have warps CellRanger cell barcode and UMI correction function as a module in our pipeline, named cellBC_UMI_corrector, these methods using long reads data independently, no need additional short read data for guiding.
/path/cellranger-3.1.0/miniconda-cr-cs/4.3.21-miniconda-cr-cs-c10/bin/python cellBC_UMI_corrector.py -w 3M-february-2018.txt -t 0.95 --input isoseq_flnc.BarcodeUMI.fastq --tmap flnc.filtered.tmap --output ./flnc.cellBC_UMI_correction.xls --cellranger_path /path/cellranger-3.1.0/
Note: you can find 3M-february-2018.txt.gz file in example_data folder in this repo or in your cellranger path: /path/cellranger-3.1.0/cellranger-cs/3.1.0/lib/python/cellranger/barcodes/3M-february-2018.txt.gz
Based on gffcompare output and corrected cellBC and UMI on each FLNC, we are using scGene_matrix utility to get the single cell gene expression quantity in each sample.
If NGS top rank cellBC list is provided, you can refer to the command line below:
perl scGene_matrix.pl -ngsbc NGScellBC.list -tgsbcumi flnc.cellBC_UMI_correction.xls -tmap flnc.filtered.tmap -outdir ./ -sample TEST
If you want using TGS top rank cellBC only, you can refer to the command line below:
perl scGene_matrix.pl -tgsbcumi flnc.cellBC_UMI_correction.xls -tmap flnc.filtered.tmap -topbc 2500 -outdir ./ -sample TEST
【Important Notice:Due to years of development, tools for RNA isoform recognition and quantification from long-read RNA sequencing data are evolving rapidly. Therefore, after obtaining well-aligned FLNC reads, it is recommended to use [IsoQuant] for subsequent isoform recognition and quantification to achieve more accurate results!】
After mapping of FLNC to genome, we then using cDNA_Cupcake(https://github.com/Magdoll/cDNA_Cupcake) python script collapse_isoforms_by_sam.py to collapse all samples isoforms, and then we using SQANTI3(https://github.com/ConesaLab/SQANTI3) to characterization non-redundant isoforms.
sort -k 3,3 -k 4,4n isoseq_flnc.Transcript.sam > isoseq_flnc.Transcript.sorted.sam
/path/anaCogent/bin/python /path/anaCogent/bin/collapse_isoforms_by_sam.py --input isoseq_flnc.Transcript.fastq --fq -s isoseq_flnc.Transcript.sorted.sam -o TEST
python /path/SQANTI3-master/sqanti3_qc.py ./all.collapsed.rep.fa ref.genes.gtf ref.genome.fa -d ./TEST --isoAnnotLite -t 30
Based on collapsed output and corrected cellBC and UMI on each FLNC, we are using scIsoform_matrix utility to get the single cell isoform expression quantity in each sample.
If NGS top rank cellBC list provided, you can refer to the command line below:
perl scIsoform_matrix.pl -ngsbc NGScellBC.list -tgsbcumi flnc.cellBC_UMI_correction.xl -group all.collapsed.group.txt -minUMIcount 3 -outdir ./ -sample TEST
If you want using TGS top rank cellBC only, you can refer to the command line below:
perl scIsoform_matrix.pl -tgsbcumi flnc.cellBC_UMI_correction.xl -topbc 2500 -group all.collapsed.group.txt -minUMIcount 3 -outdir ./ -sample TEST
Each single cell gene and isoform expression matrix was using the Seurat R package (version 3.1.5) for further quality filtering analysis.
9.1) example using Seurat for expression matrix’s quality control and using DropletUtils for text matrix convert to CellRanger output format.
rm(list=ls())
library(dplyr)
library(Seurat)
library(Matrix)
library(DropletUtils)
metadata <- read.csv(TEST. isoform.matrix, row.names =1, sep=",")
test <- CreateSeuratObject(counts = metadata, min.cells = 5, min.features = 100, project = sample_name)
test[["percent.mt"]] <- PercentageFeatureSet(test, pattern = "^MT-")
test <- subset(test, subset = nFeature_RNA > 100 & nFeature_RNA < 6000 & percent.mt < 25)
write10xCounts(x =test@assays$RNA@counts, path = ./TEST)
cd ./TEST && awk '{print $1"\t"$2"\tGene Expression"}' genes.tsv > features.tsv && rm genes.tsv && sed -i 's/\./\-/' barcodes.tsv && gzip *
After quality filtering of each sample’s single cell gene and isoform expression matrix, we using scMatrix2CellRangerH5 utility to convert matrix to CellRanger h5 format, than we using CellRanger reanalyze pipeline for PCA and cell clustering with default parameters, the resulting cloupe file was loaded to Loupe Browser for fine manual annotation cell type and tune adjustments.
/youpath/cellranger-3.1.0/miniconda-cr-cs/4.3.21-miniconda-cr-cs-c10/bin/python scMatrix2CellRangerH5.py –m ./TEST -c example.filtered_feature_bc_matrix.h5 -o ./test.h5 --cellranger_path /youpath/cellranger-3.1.0
Note: the example_data folder in this repo have an example.filtered_feature_bc_matrix.h5, you can copy and use this file for any scMatrix2CellRangerH5 task.
cellranger reanalyze --id=TEST --matrix=./test.h5 --localcores=5
If you have any questions, encounter problems or potential bugs, don’t hesitate to contact us. Report issues on github are welcome.